Product Details

SNP ID: rs114619220
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:22138716 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGGCTTCTCTCGGGGCCGGGCTG[C/G]CGCCCGGGGGACTGCCTCAGTATCT
Phenotype: MIM: 602302 MIM: 608302 MIM: 609349
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: HR PubMed Links

Gene Details

Gene: HR
Gene Name: hair growth associated

There are no transcripts associated with this gene.

Gene: LGI3
Gene Name: leucine rich repeat LGI family member 3

There are no transcripts associated with this gene.

Gene: REEP4
Gene Name: receptor accessory protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316964.1	1100	Intron			NP_001303893.1
NM_001316965.1	1100	Silent Mutation	CGC,CGG	R165R	NP_001303894.1
NM_025232.3	1100	Missense Mutation	CCA,GCA	P211A	NP_079508.2

View Full Product Details