Product Details
- SNP ID
-
hCV173951393
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.8:143718251 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCCCAACATCATCAGCCTCCTTGAC[C/G]TGATCCGGGCAGAGAACGACAGGGA
- Phenotype
-
MIM: 611927
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
FAM83H
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs56186625] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FAM83H
- Gene Name
- family with sequence similarity 83 member H
There are no transcripts associated with this gene.
- Gene
- LOC101928160
- Gene Name
- uncharacterized LOC101928160
There are no transcripts associated with this gene.
- Gene
- MAPK15
- Gene Name
- mitogen-activated protein kinase 15
There are no transcripts associated with this gene.
View Full Product Details