Product Details

SNP ID: rs141624286
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144394278 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTGTCCACCATGAAGTCCACGCTG[C/T]ACACCTCCAGGGGCTTGGCATCCTG
Phenotype: MIM: 606027
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ADCK5 PubMed Links

Gene Details

Gene: ADCK5
Gene Name: aarF domain containing kinase 5

There are no transcripts associated with this gene.

Gene: CPSF1
Gene Name: cleavage and polyadenylation specific factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013291.2	3792	Missense Mutation	TAC,TGC	Y1256C	NP_037423.2
XM_006716548.2	3792	Missense Mutation	TAC,TGC	Y1253C	XP_006716611.1
XM_006716549.2	3792	Missense Mutation	TAC,TGC	Y1178C	XP_006716612.1
XM_006716550.3	3792	Missense Mutation	TAC,TGC	Y598C	XP_006716613.1
XM_011516997.1	3792	Missense Mutation	TAC,TGC	Y1178C	XP_011515299.1
XM_011516998.1	3792	Missense Mutation	TAC,TGC	Y1178C	XP_011515300.1
XM_011516999.1	3792	Missense Mutation	TAC,TGC	Y1178C	XP_011515301.1

Gene: MIR1234
Gene Name: microRNA 1234

There are no transcripts associated with this gene.

Gene: MIR6849
Gene Name: microRNA 6849

There are no transcripts associated with this gene.

Gene: MIR939
Gene Name: microRNA 939

There are no transcripts associated with this gene.

View Full Product Details