Product Details

SNP ID: rs141981890
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.8:132024502 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCATCTATCTTCCATGAAGAGGCCC[A/G]ATCCCCAAGGGACCCAGTGACTTCC
Phenotype: MIM: 601658
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: OC90 PubMed Links
Additional Information: For this assay, SNP(s) [rs11991659] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080399.2	1500	Silent Mutation			NP_001073868.2