Product Details

SNP ID: rs142387618
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144791299 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCAACCACAGCTCTGTTGGCTGA[A/G]GAGATAACCTTCTTGGAGCCGGAGG
Phenotype: MIM: 604177 MIM: 194526
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR6850 PubMed Links

Gene Details

Gene: MIR6850
Gene Name: microRNA 6850

There are no transcripts associated with this gene.

Gene: RPL8
Gene Name: ribosomal protein L8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000973.4	612	Silent Mutation			NP_000964.1
NM_001317771.1	612	Silent Mutation			NP_001304700.1
NM_001317782.1	612	Silent Mutation			NP_001304711.1
NM_033301.2	612	Silent Mutation			NP_150644.1
XM_017013723.1	612	Silent Mutation			XP_016869212.1

Gene: ZNF34
Gene Name: zinc finger protein 34

There are no transcripts associated with this gene.

Gene: ZNF517
Gene Name: zinc finger protein 517

There are no transcripts associated with this gene.

View Full Product Details