Product Details

SNP ID: rs148618129
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:93732387 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAAAGAAGTCAAAATTCAACCACA[C/G]AAGTCTTAACAGTTATAGAGTCTTT
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FAM92A1 PubMed Links

Gene Details

Gene: FAM92A1
Gene Name: family with sequence similarity 92 member A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001283034.1	4217	Intron			NP_001269963.1
NM_145269.4	4217	Intron			NP_660312.2
XM_005250787.2	4217	Intron			XP_005250844.1

Gene: RBM12B
Gene Name: RNA binding motif protein 12B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_203390.2	4217	UTR 3			NP_976324.2
XM_005250915.4	4217	UTR 3			XP_005250972.1
XM_011517027.2	4217	UTR 3			XP_011515329.1
XM_011517028.2	4217	UTR 3			XP_011515330.1
XM_011517029.2	4217	UTR 3			XP_011515331.1
XM_017013406.1	4217	UTR 3			XP_016868895.1
XM_017013407.1	4217	UTR 3			XP_016868896.1
XM_017013408.1	4217	UTR 3			XP_016868897.1

Gene: RBM12B-AS1
Gene Name: RBM12B antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details