Product Details

SNP ID: rs138647485
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:35101263 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGACTCTAGAACTGTGGCCCGTTTC[A/C]GCCGCTCTGCCTCCACCTGGAAGCC
Phenotype: MIM: 614730 MIM: 608292
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FAM214B PubMed Links

Gene Details

Gene: FAM214B
Gene Name: family with sequence similarity 214 member B

There are no transcripts associated with this gene.

Gene: PIGO
Gene Name: phosphatidylinositol glycan anchor biosynthesis class O

There are no transcripts associated with this gene.

Gene: STOML2
Gene Name: stomatin like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001287031.1	586	Missense Mutation			NP_001273960.1
NM_001287032.1	586	Missense Mutation			NP_001273961.1
NM_001287033.1	586	Missense Mutation			NP_001273962.1
NM_013442.2	586	Missense Mutation			NP_038470.1

View Full Product Details