Product Details

SNP ID: rs140854363
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:113272476 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAACTCTTCAATGTCATCAAGCTTT[A/G]GCTCTAGGCGTGTTGGTTTCCGTCT
Phenotype: MIM: 614533 MIM: 607795 MIM: 603085
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CDC26 PubMed Links

Gene Details

Gene: CDC26
Gene Name: cell division cycle 26

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_139286.3	823	Intron			NP_644815.1
XM_017014573.1	823	Intron			XP_016870062.1
XM_017014574.1	823	Missense Mutation	CCA,CTA	P11L	XP_016870063.1
XM_017014575.1	823	Intron			XP_016870064.1

Gene: PRPF4
Gene Name: pre-mRNA processing factor 4

There are no transcripts associated with this gene.

Gene: SLC31A1
Gene Name: solute carrier family 31 member 1

There are no transcripts associated with this gene.

View Full Product Details