Product Details

SNP ID: rs142337069
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.9:35957530 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATCACATTGATGGAAATGTCAGCA[A/C]AGGCCAACTTTAGAACAGCCAGAAT
Phenotype
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: OR2S2 PubMed Links
Additional Information: For this assay, SNP(s) [rs2233565] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: OR2S2
Gene Name: olfactory receptor family 2 subfamily S member 2 (gene/pseudogene)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_019897.2	625	Missense Mutation	TGT,TTT	C190F	NP_063950.2