Product Details

SNP ID: rs142913281
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:127454569 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAAGCGGAAACCCAGTGAGGAGGC[G/T]CGGAAACGCCTGGAGTACCAGATGT
Phenotype: MIM: 610933 MIM: 180475 MIM: 194552
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LRSAM1 PubMed Links

Gene Details

Gene: LRSAM1
Gene Name: leucine rich repeat and sterile alpha motif containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005373.3	1413	Silent Mutation	GCG,GCT	A14A	NP_001005373.1
NM_001005374.3	1413	Silent Mutation	GCG,GCT	A14A	NP_001005374.1
NM_001190723.2	1413	Silent Mutation	GCG,GCT	A14A	NP_001177652.1
NM_138361.5	1413	Silent Mutation	GCG,GCT	A14A	NP_612370.3
XM_006717316.3	1413	Silent Mutation	GCG,GCT	A14A	XP_006717379.1
XM_017015283.1	1413	Silent Mutation	GCG,GCT	A14A	XP_016870772.1
XM_017015284.1	1413	UTR 5			XP_016870773.1

Gene: RPL12
Gene Name: ribosomal protein L12

There are no transcripts associated with this gene.

Gene: SNORA65
Gene Name: small nucleolar RNA, H/ACA box 65

There are no transcripts associated with this gene.

Gene: ZNF79
Gene Name: zinc finger protein 79

There are no transcripts associated with this gene.

View Full Product Details