Product Details

SNP ID: rs144816863
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:108869127 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAACTGCAGTCACTCAGTCTAGCAG[A/G]CTCAGCTTCCACTGGGTTCTTCTGT
Phenotype: MIM: 604303 MIM: 603722
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACTL7A PubMed Links

Gene Details

Gene: ACTL7A
Gene Name: actin like 7A

There are no transcripts associated with this gene.

Gene: IKBKAP
Gene Name: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318360.1	4366	Silent Mutation	AGC,AGT	S1215S	NP_001305289.1
NM_003640.4	4366	Silent Mutation	AGC,AGT	S1329S	NP_003631.2
XM_011519136.1	4366	Silent Mutation	AGC,AGT	S1343S	XP_011517438.1
XM_011519137.1	4366	Silent Mutation	AGC,AGT	S1229S	XP_011517439.1
XM_017015238.1	4366	Silent Mutation	AGC,AGT	S980S	XP_016870727.1

View Full Product Details