Product Details

SNP ID: rs147130795
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:133356961 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGAGCTGCCCTGCCGCCTGCCGGA[C/G]CTCCAGGTCTACACCCGCGGCAAAA
Phenotype: MIM: 185641 MIM: 185640 MIM: 185620 MIM: 185630 MIM: 185660
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MED22 PubMed Links

Gene Details

Gene: MED22
Gene Name: mediator complex subunit 22

There are no transcripts associated with this gene.

Gene: RPL7A
Gene Name: ribosomal protein L7a

There are no transcripts associated with this gene.

Gene: SNORD24
Gene Name: small nucleolar RNA, C/D box 24

There are no transcripts associated with this gene.

Gene: SNORD36A
Gene Name: small nucleolar RNA, C/D box 36A

There are no transcripts associated with this gene.

Gene: SNORD36B
Gene Name: small nucleolar RNA, C/D box 36B

There are no transcripts associated with this gene.

Gene: SNORD36C
Gene Name: small nucleolar RNA, C/D box 36C

There are no transcripts associated with this gene.

Gene: SURF1
Gene Name: surfeit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001280787.1	174	Intron			NP_001267716.1
NM_003172.3	174	Intron			NP_003163.1
XM_011518942.1	174	Intron			XP_011517244.1

Gene: SURF2
Gene Name: surfeit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278928.1	174	Missense Mutation	GAC,GAG	D42E	NP_001265857.1
NM_017503.4	174	Missense Mutation	GAC,GAG	D42E	NP_059973.4

Gene: SURF4
Gene Name: surfeit 4

There are no transcripts associated with this gene.

View Full Product Details