Product Details

SNP ID: rs147594403
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:34617898 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCCAGCATTACCTGCTAGGATGAA[C/T]TGCAGCTTAGAGGCATCAGGTATGG
Phenotype: MIM: 607387
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARID3C PubMed Links

Gene Details

Gene: ARID3C
Gene Name: AT-rich interaction domain 3C

There are no transcripts associated with this gene.

Gene: DCTN3
Gene Name: dynactin subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281425.1	314	Silent Mutation	CAA,CAG	Q85Q	NP_001268354.1
NM_001281426.1	314	Silent Mutation	CAA,CAG	Q85Q	NP_001268355.1
NM_001281427.1	314	Silent Mutation	CAA,CAG	Q85Q	NP_001268356.1
NM_007234.4	314	Silent Mutation	CAA,CAG	Q85Q	NP_009165.1
NM_024348.3	314	Silent Mutation	CAA,CAG	Q85Q	NP_077324.1

Gene: RPP25L
Gene Name: ribonuclease P/MRP subunit p25 like

There are no transcripts associated with this gene.

View Full Product Details