Product Details

SNP ID: rs148210033
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:136721957 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGCAAGGGGATCATCTCGGGCTCC[A/G]TCTGCCAGGACCTGTGTGAGCTGCA
Phenotype: MIM: 614543
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM69B PubMed Links

Gene Details

Gene: FAM69B
Gene Name: family with sequence similarity 69 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152421.3	460	Missense Mutation	ATC,GTC	I79V	NP_689634.2
XM_006716954.3	460	Missense Mutation	ATC,GTC	I82V	XP_006717017.1
XM_011518238.2	460	Missense Mutation	ATC,GTC	I124V	XP_011516540.1
XM_017014273.1	460	UTR 5			XP_016869762.1

Gene: SNHG7
Gene Name: small nucleolar RNA host gene 7

There are no transcripts associated with this gene.

Gene: SNORA17A
Gene Name: small nucleolar RNA, H/ACA box 17A

There are no transcripts associated with this gene.

Gene: SNORA17B
Gene Name: small nucleolar RNA, H/ACA box 17B

There are no transcripts associated with this gene.

View Full Product Details