Product Details

SNP ID: rs149172628
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137169532 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCAGCGCGCGCAGCGGCGCGAAAG[C/T]CCCTGGTGCCAGTGCTTCCAGCTGG
Phenotype: MIM: 606946 MIM: 138249 MIM: 613505
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ANAPC2 PubMed Links

Gene Details

Gene: ANAPC2
Gene Name: anaphase promoting complex subunit 2

There are no transcripts associated with this gene.

Gene: GRIN1
Gene Name: glutamate ionotropic receptor NMDA type subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000832.6	508	Intron			NP_000823.4
NM_001185090.1	508	Intron			NP_001172019.1
NM_001185091.1	508	Intron			NP_001172020.1
NM_007327.3	508	Intron			NP_015566.1
NM_021569.3	508	Intron			NP_067544.1
XM_005266071.3	508	Intron			XP_005266128.1
XM_005266072.3	508	Intron			XP_005266129.1
XM_005266073.4	508	Intron			XP_005266130.1
XM_011518583.2	508	Intron			XP_011516885.1

Gene: LRRC26
Gene Name: leucine rich repeat containing 26

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013653.2	508	Missense Mutation			NP_001013675.1

Gene: MIR3621
Gene Name: microRNA 3621

There are no transcripts associated with this gene.

Gene: TMEM210
Gene Name: transmembrane protein 210

There are no transcripts associated with this gene.

View Full Product Details