Product Details

SNP ID: rs139605296
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:152736574 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCACAAAGGCAGAAATGCTGGGGA[G/C]TGTCATCAGAAATTTCCAGGACTTC
Phenotype: MIM: 300944 MIM: 300177
Polymorphism: G/C, Transversion substitution
Allele Nomenclature
Literature Links: CSAG1 PubMed Links

Gene Details

Gene: CSAG1
Gene Name: chondrosarcoma associated gene 1

There are no transcripts associated with this gene.

Gene: CSAG4
Gene Name: CSAG family member 4 (pseudogene)

There are no transcripts associated with this gene.

Gene: MAGEA12
Gene Name: MAGE family member A12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001166386.3	767	Missense Mutation	ACT,AGT	T138S	NP_001159858.1
NM_001166387.3	767	Missense Mutation	ACT,AGT	T138S	NP_001159859.1
NM_005367.6	767	Missense Mutation	ACT,AGT	T138S	NP_005358.2

View Full Product Details