Product Details

SNP ID: rs148444371
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:134543566 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTAGTTTTCCAAGTAACATTGACAC[A/G]CATCTGTTCAAATCAGTTGAGGTTC
Phenotype: MIM: 300682 MIM: 300865
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LINC00629 PubMed Links

Gene Details

Gene: LINC00629
Gene Name: long intergenic non-protein coding RNA 629

There are no transcripts associated with this gene.

Gene: MIR424
Gene Name: microRNA 424

There are no transcripts associated with this gene.

Gene: MIR450A1
Gene Name: microRNA 450a-1

There are no transcripts associated with this gene.

Gene: MIR450A2
Gene Name: microRNA 450a-2

There are no transcripts associated with this gene.

Gene: MIR450B
Gene Name: microRNA 450b

There are no transcripts associated with this gene.

Gene: MIR503
Gene Name: microRNA 503

There are no transcripts associated with this gene.

Gene: MIR503HG
Gene Name: MIR503 host gene

There are no transcripts associated with this gene.

Gene: MIR542
Gene Name: microRNA 542

There are no transcripts associated with this gene.

View Full Product Details