Product Details

SNP ID: rs1052925
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:116836053 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCAGCTCGTCGCTGTAGGGGGCCA[A/G]ATGCGTGCGCAGCGCGTCCACATGG
Phenotype: MIM: 107680 MIM: 107720 MIM: 614776
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APOA1 PubMed Links

Gene Details

Gene: APOA1
Gene Name: apolipoprotein A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000039.2	630	Silent Mutation	CTG,TTG	L187L	NP_000030.1
NM_001318017.1	630	Silent Mutation	CTG,TTG	L187L	NP_001304946.1
NM_001318018.1	630	Silent Mutation	CTG,TTG	L187L	NP_001304947.1
NM_001318021.1	630	Silent Mutation	CTG,TTG	L78L	NP_001304950.1

Gene: APOA1-AS
Gene Name: APOA1 antisense RNA

There are no transcripts associated with this gene.

Gene: APOC3
Gene Name: apolipoprotein C3

There are no transcripts associated with this gene.

Gene: SIK3
Gene Name: SIK family kinase 3

There are no transcripts associated with this gene.

View Full Product Details