Product Details

SNP ID: rs1131195
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:241678635 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCCACGTCTGGCTGTTTACACCA[A/G]TCTAGGGAAAAATTCTGCCAAGAAA
Phenotype: MIM: 611338 MIM: 188345 MIM: 608525
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATG4B PubMed Links

Gene Details

Gene: ATG4B
Gene Name: autophagy related 4B cysteine peptidase

There are no transcripts associated with this gene.

Gene: DTYMK
Gene Name: deoxythymidylate kinase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001165031.1	473	Intron			NP_001158503.1
NM_001320902.1	473	Silent Mutation	GAC,GAT	D72D	NP_001307831.1
NM_001320903.1	473	Intron			NP_001307832.1
NM_001320904.1	473	Silent Mutation	GAC,GAT	D96D	NP_001307833.1
NM_001320905.1	473	Silent Mutation	GAC,GAT	D154D	NP_001307834.1
NM_012145.3	473	Silent Mutation	GAC,GAT	D115D	NP_036277.2

Gene: ING5
Gene Name: inhibitor of growth family member 5

There are no transcripts associated with this gene.

View Full Product Details