Product Details
- SNP ID
-
rs6010763
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.20:62845881 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCGTGTGGAGAAACAGTGCCAGTGC[C/T]TTCAGTCAACAAAGAATGAGTTAAA
- Phenotype
-
MIM: 120270
MIM: 604745
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
COL9A3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs57610632] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- COL9A3
- Gene Name
- collagen type IX alpha 3
There are no transcripts associated with this gene.
- Gene
- DPH3P1
- Gene Name
- diphthamide biosynthesis 3 pseudogene 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_080750.4 |
1614 |
Intron |
|
|
NP_542788.1 |
- Gene
- TCFL5
- Gene Name
- transcription factor like 5
View Full Product Details