Product Details

SNP ID: rs11541134
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:3663563 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATCCTCGGTGTCCAGGAGAGAAAGC[C/T]GGTCCCAGAGGCCCCAGGCCAGGGA
Phenotype: MIM: 606272 MIM: 602836 MIM: 616484
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CTNS PubMed Links

Gene Details

Gene: CTNS
Gene Name: cystinosin, lysosomal cystine transporter

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031681.2	713	Intron			NP_001026851.2
NM_004937.2	713	Intron			NP_004928.2
XM_005256485.2	713	Intron			XP_005256542.1
XM_006721463.2	713	Intron			XP_006721526.1
XM_006721464.2	713	Intron			XP_006721527.1
XM_011523691.2	713	Intron			XP_011521993.1
XM_011523692.2	713	Intron			XP_011521994.1
XM_017024254.1	713	Intron			XP_016879743.1
XM_017024255.1	713	Intron			XP_016879744.1
XM_017024256.1	713	Intron			XP_016879745.1
XM_017024257.1	713	Intron			XP_016879746.1
XM_017024258.1	713	Intron			XP_016879747.1

Gene: EMC6
Gene Name: ER membrane protein complex subunit 6

There are no transcripts associated with this gene.

Gene: P2RX5
Gene Name: purinergic receptor P2X 5

There are no transcripts associated with this gene.

Gene: P2RX5-TAX1BP3
Gene Name: P2RX5-TAX1BP3 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TAX1BP3
Gene Name: Tax1 binding protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204698.1	713	UTR 3			NP_001191627.1
NM_014604.3	713	UTR 3			NP_055419.1

View Full Product Details