Product Details

SNP ID: rs11547778
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:6644537 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGCTGAAGGCGCATCCGCTTCCGG[A/G]AATAGTGCTGCCAATGTAGAATCTG
Phenotype: MIM: 616967
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C17orf100 PubMed Links

Gene Details

Gene: C17orf100
Gene Name: chromosome 17 open reading frame 100

There are no transcripts associated with this gene.

Gene: KIAA0753
Gene Name: KIAA0753

There are no transcripts associated with this gene.

Gene: MED31
Gene Name: mediator complex subunit 31

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016060.2	505	Missense Mutation	TCC,TTC	S109F	NP_057144.1
XM_017024710.1	505	UTR 3			XP_016880199.1

Gene: TXNDC17
Gene Name: thioredoxin domain containing 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032731.3	505	UTR 3			NP_116120.1

View Full Product Details