Product Details

SNP ID: rs181506864
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:129404271 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGCTTGTCAGTCCTCTTAGACTTG[A/C]CAGGGCCCTGGGACCGGAGCAGAGC
Phenotype
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: EFCAB12 PubMed Links

Gene Details

Gene: EFCAB12
Gene Name: EF-hand calcium binding domain 12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207307.2	1545	Missense Mutation	GGC,GTC	G461V	NP_997190.1
XM_011513293.2	1545	Missense Mutation	GGC,GTC	G499V	XP_011511595.1
XM_011513294.2	1545	Missense Mutation	GGC,GTC	G498V	XP_011511596.1
XM_011513295.2	1545	Missense Mutation	GGC,GTC	G484V	XP_011511597.1
XM_011513297.2	1545	Intron			XP_011511599.1
XM_011513298.1	1545	Missense Mutation	GGC,GTC	G214V	XP_011511600.1
XM_011513299.2	1545	Missense Mutation	GGC,GTC	G207V	XP_011511601.1

Gene: RPL32P3
Gene Name: ribosomal protein L32 pseudogene 3

There are no transcripts associated with this gene.

Gene: SNORA7B
Gene Name: small nucleolar RNA, H/ACA box 7B

There are no transcripts associated with this gene.

View Full Product Details