Product Details

SNP ID: rs182664213
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1275723 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCGGGCGCGCCACACAACAGCAC[A/G]CACACGCGTCCGCCGGGGGCGTCGG
Phenotype: MIM: 602649 MIM: 602756
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C19orf24 PubMed Links

Gene Details

Gene: C19orf24
Gene Name: chromosome 19 open reading frame 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017914.3	203	Silent Mutation	ACA,ACG	T58T	NP_060384.3

Gene: CIRBP
Gene Name: cold inducible RNA binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001280.2	203	Intron			NP_001271.1
NM_001300815.1	203	Intron			NP_001287744.1
NM_001300829.1	203	Intron			NP_001287758.1
XM_006722637.1	203	Intron			XP_006722700.1
XM_011527668.1	203	Intron			XP_011525970.1
XM_017026237.1	203	Intron			XP_016881726.1

Gene: CIRBP-AS1
Gene Name: CIRBP antisense RNA 1

There are no transcripts associated with this gene.

Gene: EFNA2
Gene Name: ephrin A2

There are no transcripts associated with this gene.

View Full Product Details