Product Details

SNP ID: rs183327697
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100149510 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTTTACCCACTAGACTTCTGCGCT[A/G]ACCCAGGGGCTGGAGCGAATCCCAG
Phenotype: MIM: 608235
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C7orf43 PubMed Links

Gene Details

Gene: C7orf43
Gene Name: chromosome 7 open reading frame 43

There are no transcripts associated with this gene.

Gene: GAL3ST4
Gene Name: galactose-3-O-sulfotransferase 4

There are no transcripts associated with this gene.

Gene: LAMTOR4
Gene Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008395.3	89	Silent Mutation	CTA,CTG	L5L	NP_001008396.1
NM_001318236.1	89	Silent Mutation	CTA,CTG	L5L	NP_001305165.1
NM_001318237.1	89	Intron			NP_001305166.1
XM_017012198.1	89	Silent Mutation	CTA,CTG	L5L	XP_016867687.1
XM_017012199.1	89	Silent Mutation	CTA,CTG	L5L	XP_016867688.1

Gene: MIR4658
Gene Name: microRNA 4658

There are no transcripts associated with this gene.

View Full Product Details