Product Details

SNP ID: rs183208634
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:42965126 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAGCTGGGAGGCCCGGTCCTCATTT[A/G]CCCCCACAAACACCAGCTTGTCAAA
Phenotype: MIM: 606628 MIM: 601498
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CNPY3-GNMT PubMed Links

Gene Details

Gene: CNPY3-GNMT
Gene Name: CNPY3-GNMT readthrough

There are no transcripts associated with this gene.

Gene: GNMT
Gene Name: glycine N-methyltransferase

There are no transcripts associated with this gene.

Gene: PEX6
Gene Name: peroxisomal biogenesis factor 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000287.3	2708	Missense Mutation	GCA,GTA	A872V	NP_000278.3
NM_001316313.1	2708	Missense Mutation	GCA,GTA	A784V	NP_001303242.1
XM_011514661.1	2708	Missense Mutation	GCA,GTA	A844V	XP_011512963.1

View Full Product Details