Product Details

SNP ID: rs182928543
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:26180587 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGACACCAGGAGCTCATCCTGGGC[A/G]GGGTGGAACAGCTCCAGGCCCTGGT
Phenotype: MIM: 609121 MIM: 603272 MIM: 616698
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CATSPER4 PubMed Links

Gene Details

Gene: CATSPER4
Gene Name: cation channel sperm associated 4

There are no transcripts associated with this gene.

Gene: CNKSR1
Gene Name: connector enhancer of kinase suppressor of Ras 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297647.1	245	Missense Mutation	AGG,GGG	R63G	NP_001284576.1
NM_001297648.1	245	UTR 5			NP_001284577.1
NM_006314.2	245	Missense Mutation	AGG,GGG	R63G	NP_006305.2
XM_011540484.2	245	UTR 5			XP_011538786.1
XM_011540485.2	245	Intron			XP_011538787.1

Gene: ZNF593
Gene Name: zinc finger protein 593

There are no transcripts associated with this gene.

View Full Product Details