Product Details

SNP ID: rs184898622
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54191403 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGTGGCGAACGGCCGCTCCCTGGT[A/G]TGGGGAGCCGAGGCGGTGCAGGCCC
Phenotype: MIM: 606048 MIM: 603631 MIM: 608754
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MBOAT7 PubMed Links

Gene Details

Gene: MBOAT7
Gene Name: membrane bound O-acyltransferase domain containing 7

There are no transcripts associated with this gene.

Gene: RPS9
Gene Name: ribosomal protein S9

There are no transcripts associated with this gene.

Gene: TSEN34
Gene Name: tRNA splicing endonuclease subunit 34

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077446.3	142	Silent Mutation	GTA,GTG	V13V	NP_001070914.1
NM_001282332.1	142	Silent Mutation	GTA,GTG	V13V	NP_001269261.1
NM_001282333.1	142	Silent Mutation	GTA,GTG	V16V	NP_001269262.1
NM_024075.4	142	Silent Mutation	GTA,GTG	V13V	NP_076980.2
XM_005278290.4	142	Silent Mutation	GTA,GTG	V16V	XP_005278347.1
XM_011527294.2	142	Silent Mutation	GTA,GTG	V13V	XP_011525596.1
XM_011527295.1	142	Silent Mutation	GTA,GTG	V13V	XP_011525597.1

View Full Product Details