Product Details

SNP ID: rs184734292
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:33289901 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAAGCTACAGGGAGAAGTGGAGAA[A/G]TATCAACAGCTACAGAAGGGTAAGG
Phenotype: MIM: 605660 MIM: 602306 MIM: 601962 MIM: 611440
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR6834 PubMed Links

Gene Details

Gene: MIR6834
Gene Name: microRNA 6834

There are no transcripts associated with this gene.

Gene: MIR6873
Gene Name: microRNA 6873

There are no transcripts associated with this gene.

Gene: PFDN6
Gene Name: prefoldin subunit 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001185181.2	164	Silent Mutation	AAA,AAG	K15K	NP_001172110.1
NM_001265595.1	164	Silent Mutation	AAA,AAG	K15K	NP_001252524.1
NM_001265596.1	164	Silent Mutation	AAA,AAG	K15K	NP_001252525.1
NM_014260.3	164	Silent Mutation	AAA,AAG	K15K	NP_055075.1

Gene: RGL2
Gene Name: ral guanine nucleotide dissociation stimulator like 2

There are no transcripts associated with this gene.

Gene: TAPBP
Gene Name: TAP binding protein (tapasin)

There are no transcripts associated with this gene.

Gene: WDR46
Gene Name: WD repeat domain 46

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164267.1	164	Intron			NP_001157739.1
NM_005452.5	164	Intron			NP_005443.3
XM_017011484.1	164	Intron			XP_016866973.1
XM_017011485.1	164	Intron			XP_016866974.1
XM_017011486.1	164	Intron			XP_016866975.1
XM_017011487.1	164	Intron			XP_016866976.1

View Full Product Details