Product Details

SNP ID: rs186342970
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:212043090 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTATGGAGAAACAGGAGTCCCAGT[G/T]CCTCCTTTTGGATGTACCTTCTCTT
Phenotype: MIM: 610617 MIM: 611350
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DTL PubMed Links

Gene Details

Gene: DTL
Gene Name: denticleless E3 ubiquitin protein ligase homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286229.1	192	Intron			NP_001273158.1
NM_001286230.1	192	Intron			NP_001273159.1
NM_016448.3	192	Silent Mutation	GTG,GTT	V50V	NP_057532.3
XM_011509614.1	192	UTR 5			XP_011507916.1

Gene: INTS7
Gene Name: integrator complex subunit 7

There are no transcripts associated with this gene.

Gene: RPL21P28
Gene Name: ribosomal protein L21 pseudogene 28

There are no transcripts associated with this gene.

View Full Product Details