Product Details

SNP ID: rs186432230
Assay Type: Functionally tested
NCBI dbSNP Submissions: 4
Location: Chr.1:153969366 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGCCCAGCATTTATGGTGCCTGAT[G/T]CCTGCATGGTCAGTGAGCTGCCCTT
Phenotype: MIM: 607138 MIM: 604671 MIM: 604740
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CREB3L4 PubMed Links

Gene Details

Gene: CREB3L4
Gene Name: cAMP responsive element binding protein 3 like 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001255978.1	692	Missense Mutation	GCC,TCC	A152S	NP_001242907.1
NM_001255979.1	692	Missense Mutation	GCC,TCC	A152S	NP_001242908.1
NM_001255980.1	692	Missense Mutation	GCC,TCC	A132S	NP_001242909.1
NM_001255981.1	692	Missense Mutation	GCC,TCC	A132S	NP_001242910.1
NM_130898.3	692	Missense Mutation	GCC,TCC	A152S	NP_570968.1
XM_006711172.2	692	Missense Mutation	GCC,TCC	A132S	XP_006711235.1
XM_017000372.1	692	Missense Mutation	GCC,TCC	A132S	XP_016855861.1

Gene: JTB
Gene Name: jumping translocation breakpoint

There are no transcripts associated with this gene.

Gene: MIR6737
Gene Name: microRNA 6737

There are no transcripts associated with this gene.

Gene: SLC39A1
Gene Name: solute carrier family 39 member 1

There are no transcripts associated with this gene.

View Full Product Details