Product Details

SNP ID: rs186459505
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:52907083 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTAAATGGTACCTTTGGTGAAGGAG[A/G]TTTATTTTCATCGTCAGAAAATGAA
Phenotype: MIM: 607319
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: SFMBT1 PubMed Links

Gene Details

Gene: SFMBT1
Gene Name: Scm-like with four mbt domains 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016329.3	2943	Missense Mutation	CCT,TCT	P773S	NP_057413.2
XM_005265221.3	2943	Missense Mutation	CCT,TCT	P773S	XP_005265278.1
XM_006713203.3	2943	Missense Mutation	CCT,TCT	P773S	XP_006713266.1
XM_006713204.3	2943	Missense Mutation	CCT,TCT	P773S	XP_006713267.1
XM_011533824.2	2943	Missense Mutation	CCT,TCT	P773S	XP_011532126.1
XM_011533825.2	2943	Missense Mutation	CCT,TCT	P773S	XP_011532127.1

Gene: TMEM110
Gene Name: transmembrane protein 110

There are no transcripts associated with this gene.

Gene: TMEM110-MUSTN1
Gene Name: TMEM110-MUSTN1 readthrough

There are no transcripts associated with this gene.

View Full Product Details