Product Details

SNP ID: rs187119710
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:128865413 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCGGGATGACATTGGCATCATCCT[C/T]ATCAACCAGTACATCGCAGAGATGG
Phenotype: MIM: 607160 MIM: 102565 MIM: 609344
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ATP6V1F PubMed Links

Gene Details

Gene: ATP6V1F
Gene Name: ATPase H+ transporting V1 subunit F

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198909.1		Intron			NP_001185838.1
NM_004231.3		Intron			NP_004222.2

Gene: FLNC
Gene Name: filamin C

There are no transcripts associated with this gene.

Gene: KCP
Gene Name: kielin/chordin-like protein

There are no transcripts associated with this gene.

Gene: LOC100130705
Gene Name: uncharacterized LOC100130705

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195150.1		Intron			NP_001182079.1

View Full Product Details