Product Details
- SNP ID
-
rs186725683
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:59210121 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGCCTGGATGGGCTCTGAAAGTCCC[A/G]GAGGGTCCCCTACTGAGGGCGGAGG
- Phenotype
-
MIM: 615920
MIM: 613175
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PRR11
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs6503905] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PRR11
- Gene Name
- proline rich 11
There are no transcripts associated with this gene.
- Gene
- SMG8
- Gene Name
- SMG8, nonsense mediated mRNA decay factor
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_018149.6 |
112 |
Missense Mutation |
AGA,GGA |
R24G |
NP_060619.4 |
View Full Product Details