Product Details

SNP ID: rs187325799
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49684808 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCACGCTGTATGTGACGGCCATC[A/G]AGGACCGGCAGTACAAAGACTACAA
Phenotype: MIM: 608846 MIM: 602950
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ADM5 PubMed Links

Gene Details

Gene: ADM5
Gene Name: adrenomedullin 5 (putative)

There are no transcripts associated with this gene.

Gene: CPT1C
Gene Name: carnitine palmitoyltransferase 1C

There are no transcripts associated with this gene.

Gene: MIR5088
Gene Name: microRNA 5088

There are no transcripts associated with this gene.

Gene: PRMT1
Gene Name: protein arginine methyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207042.2	727	Intron			NP_001193971.1
NM_001536.5	727	Missense Mutation	AAG,GAG	K204E	NP_001527.3
NM_198318.4	727	Missense Mutation	AAG,GAG	K186E	NP_938074.2
XM_005258842.1	727	Missense Mutation	AAG,GAG	K175E	XP_005258899.1
XM_017026734.1	727	Missense Mutation	AAG,GAG	K180E	XP_016882223.1
XM_017026735.1	727	Missense Mutation	AAG,GAG	K180E	XP_016882224.1
XM_017026736.1	727	Missense Mutation	AAG,GAG	K175E	XP_016882225.1

View Full Product Details