Product Details

SNP ID: rs188574195
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67648254 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCCGCAGCTCTTCGCAGCGGTAT[C/T]CCGAGGCTGCTGCACCAGCCTTACC
Phenotype: MIM: 609377 MIM: 610859 MIM: 604167
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACD PubMed Links

Gene Details

Gene: ACD
Gene Name: adrenocortical dysplasia homolog

There are no transcripts associated with this gene.

Gene: CARMIL2
Gene Name: capping protein regulator and myosin 1 linker 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013838.1	1424	Missense Mutation	TCC,TTC	S425F	NP_001013860.1
NM_001317026.1	1424	Missense Mutation	TCC,TTC	S389F	NP_001303955.1
XM_011522874.1	1424	Missense Mutation	TCC,TTC	S394F	XP_011521176.1
XM_011522875.2	1424	Missense Mutation	TCC,TTC	S394F	XP_011521177.2
XM_017022953.1	1424	Missense Mutation	TCC,TTC	S394F	XP_016878442.1

Gene: CTCF
Gene Name: CCCTC-binding factor

There are no transcripts associated with this gene.

View Full Product Details