Product Details

SNP ID: rs188632527
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28715042 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGCCTCCAACTCACCAGTGAGAGA[A/T]GAGACTGCCCAGTACTCAGCCTTCA
Phenotype: MIM: 610917 MIM: 602326
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: NARR PubMed Links

Gene Details

Gene: NARR
Gene Name: nine-amino acid residue-repeats

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256281.1	766	Intron			NP_001243210.1

Gene: PROCA1
Gene Name: protein interacting with cyclin A1

There are no transcripts associated with this gene.

Gene: RAB34
Gene Name: RAB34, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142624.2	766	Silent Mutation	TCA,TCT	S247S	NP_001136096.2
NM_001142625.2	766	Intron			NP_001136097.2
NM_001144942.1	766	Silent Mutation	TCA,TCT	S190S	NP_001138414.1
NM_001144943.1	766	Silent Mutation	TCA,TCT	S255S	NP_001138415.1
NM_001256276.1	766	Silent Mutation	TCA,TCT	S176S	NP_001243205.1
NM_001256277.1	766	Silent Mutation	TCA,TCT	S198S	NP_001243206.1
NM_001256278.1	766	Silent Mutation	TCA,TCT	S198S	NP_001243207.1
NM_031934.5	766	Silent Mutation	TCA,TCT	S198S	NP_114140.4

Gene: RPL23A
Gene Name: ribosomal protein L23a

There are no transcripts associated with this gene.

Gene: SNORD42A
Gene Name: small nucleolar RNA, C/D box 42A

There are no transcripts associated with this gene.

Gene: SNORD42B
Gene Name: small nucleolar RNA, C/D box 42B

There are no transcripts associated with this gene.

Gene: SNORD4A
Gene Name: small nucleolar RNA, C/D box 4A

There are no transcripts associated with this gene.

Gene: SNORD4B
Gene Name: small nucleolar RNA, C/D box 4B

There are no transcripts associated with this gene.

Gene: TLCD1
Gene Name: TLC domain containing 1

There are no transcripts associated with this gene.

View Full Product Details