Product Details
- SNP ID
-
rs1893
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.5:177449026 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- AGGGAGCCGCTCAGCTCCAATCTTT[A/G]TCACTGTGTGAAATGTGGACTTGGT
- Phenotype
-
MIM: 126660
MIM: 600869
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
DBN1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs10055093] are located under a probe and SNP(s) [rs466256] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DBN1
- Gene Name
- drebrin 1
There are no transcripts associated with this gene.
- Gene
- GRK6
- Gene Name
- G protein-coupled receptor kinase 6
There are no transcripts associated with this gene.
- Gene
- PRR7
- Gene Name
- proline rich 7 (synaptic)
- Gene
- PRR7-AS1
- Gene Name
- PRR7 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details