Product Details

SNP ID: rs189337482
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:176620815 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTGGGGGCTCTCCTGGGCCCCTAC[A/G]CCTCTGGCTCATACTCCTGATATTC
Phenotype: MIM: 602569
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EIF4E1B PubMed Links

Gene Details

Gene: EIF4E1B
Gene Name: eukaryotic translation initiation factor 4E family member 1B

There are no transcripts associated with this gene.

Gene: MIR4281
Gene Name: microRNA 4281

There are no transcripts associated with this gene.

Gene: SNCB
Gene Name: synuclein beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001502.2	692	Missense Mutation	GCG,GTG	A134V	NP_001001502.1
NM_001318034.1	692	Missense Mutation	GCG,GTG	A120V	NP_001304963.1
NM_001318035.1	692	Missense Mutation	GCG,GTG	A104V	NP_001304964.1
NM_001318036.1	692	Missense Mutation	GCG,GTG	A120V	NP_001304965.1
NM_001318037.1	692	Missense Mutation	GCG,GTG	A104V	NP_001304966.1
NM_003085.4	692	Missense Mutation	GCG,GTG	A134V	NP_003076.1
XM_006714914.3	692	Intron			XP_006714977.1
XM_006714915.3	692	Intron			XP_006714978.1
XM_006714916.2	692	Missense Mutation	GCG,GTG	A134V	XP_006714979.1
XM_011534640.2	692	Intron			XP_011532942.1

View Full Product Details