Product Details

SNP ID: rs189568285
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.11:27496156 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTTAGAACCACCTGGAAAGCTTTA[A/C]AAAAAAAAAAAAAAGGGTGATTTTG
Phenotype: MIM: 612332
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: LIN7C PubMed Links
Additional Information: For this assay, SNP(s) [rs111506157] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018362.3	3114	UTR 3			NP_060832.1