Product Details

SNP ID: rs191015799
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:63832948 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGATCCCTGAGCAGTTAGGTCAGG[C/T]GAATTCCCAGCACCTGTTCCAGTTC
Phenotype: MIM: 601681 MIM: 601736
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FTSJ3 PubMed Links

Gene Details

Gene: FTSJ3
Gene Name: FtsJ homolog 3

There are no transcripts associated with this gene.

Gene: PSMC5
Gene Name: proteasome 26S subunit, ATPase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199163.1	1450	Intron			NP_001186092.1
NM_002805.5	1450	Intron			NP_002796.4

Gene: SMARCD2
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098426.1	1450	Missense Mutation	CAC,CGC	H529R	NP_001091896.1
XM_005257604.2	1450	Missense Mutation	CAC,CGC	H454R	XP_005257661.2
XM_017024967.1	1450	Missense Mutation	CAC,CGC	H481R	XP_016880456.1

View Full Product Details