Product Details

SNP ID: rs190547766
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6536524 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCGTATTGGGCGCCTGGTCACCAG[A/G]GCTGCTTTTAACTCTGGTAAAGTGG
Phenotype: MIM: 138400 MIM: 610495 MIM: 615638
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GAPDH PubMed Links

Gene Details

Gene: GAPDH
Gene Name: glyceraldehyde-3-phosphate dehydrogenase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256799.2	340	UTR 5			NP_001243728.1
NM_001289745.1	340	Silent Mutation			NP_001276674.1
NM_001289746.1	340	Intron			NP_001276675.1
NM_002046.5	340	Silent Mutation			NP_002037.2

Gene: IFFO1
Gene Name: intermediate filament family orphan 1

There are no transcripts associated with this gene.

Gene: NCAPD2
Gene Name: non-SMC condensin I complex subunit D2

There are no transcripts associated with this gene.

View Full Product Details