Product Details

SNP ID: rs191800330
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144474955 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCTCCGTTCTGCCAGCGCCGGCA[C/T]AGGGCGGTGTTCTGCAGCCGGAGCG
Phenotype: MIM: 616635 MIM: 603621 MIM: 615216 MIM: 609172
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CYHR1 PubMed Links

Gene Details

Gene: CYHR1
Gene Name: cysteine and histidine rich 1

There are no transcripts associated with this gene.

Gene: FOXH1
Gene Name: forkhead box H1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003923.2	960	Silent Mutation	CTA,CTG	L127L	NP_003914.1

Gene: KIFC2
Gene Name: kinesin family member C2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145754.3	960	Intron			NP_665697.1
XM_005272357.3	960	Intron			XP_005272414.1
XM_011517362.2	960	Intron			XP_011515664.1

Gene: PPP1R16A
Gene Name: protein phosphatase 1 regulatory subunit 16A

There are no transcripts associated with this gene.

View Full Product Details