Product Details
- SNP ID
-
rs192683197
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.9:124857996 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCTTCTTGGTCTTCAGGTTCTCCTC[A/G]TGCTTGTTGAGCCGGCGGCGCATGG
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ARPC5L
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs876663] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ARPC5L
- Gene Name
- actin related protein 2/3 complex subunit 5 like
There are no transcripts associated with this gene.
- Gene
- RPL35
- Gene Name
- ribosomal protein L35
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_007209.3 |
|
Intron |
|
|
NP_009140.1 |
- Gene
- WDR38
- Gene Name
- WD repeat domain 38
View Full Product Details