Product Details

SNP ID: rs192391655
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:22162625 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTTGGCATTCCCTGCTGCCCAGTG[C/T]ACCTGAAACGCCTTCTTATCGTGGT
Phenotype: MIM: 112264 MIM: 608302 MIM: 178620
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BMP1 PubMed Links

Gene Details

Gene: BMP1
Gene Name: bone morphogenetic protein 1

There are no transcripts associated with this gene.

Gene: LGI3
Gene Name: leucine rich repeat LGI family member 3

There are no transcripts associated with this gene.

Gene: SFTPC
Gene Name: surfactant protein C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001172357.1	252	Missense Mutation	CAC,TAC	H32Y	NP_001165828.1
NM_001172410.1	252	Missense Mutation	CAC,TAC	H32Y	NP_001165881.1
NM_001317778.1	252	Missense Mutation	CAC,TAC	H32Y	NP_001304707.1
NM_001317779.1	252	Intron			NP_001304708.1
NM_001317780.1	252	Missense Mutation	CAC,TAC	H32Y	NP_001304709.1
NM_003018.3	252	Missense Mutation	CAC,TAC	H32Y	NP_003009.2
XM_011544613.2	252	Intron			XP_011542915.1

View Full Product Details