Product Details

SNP ID: rs192844575
Assay Type: Functionally tested
NCBI dbSNP Submissions: 4
Location: Chr.1:19219384 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGCAAAAACCAGGCCAAAGAGGAC[A/G]CTGCTGATTAACACGTAGTCATAGT
Phenotype: MIM: 616846 MIM: 609890
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EMC1 PubMed Links

Gene Details

Gene: EMC1
Gene Name: ER membrane protein complex subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271427.1	2951	Silent Mutation	AGC,AGT	S966S	NP_001258356.1
NM_001271428.1	2951	Silent Mutation	AGC,AGT	S966S	NP_001258357.1
NM_001271429.1	2951	Silent Mutation	AGC,AGT	S945S	NP_001258358.1
NM_015047.2	2951	Silent Mutation	AGC,AGT	S967S	NP_055862.1
XM_005245787.1	2951	Silent Mutation	AGC,AGT	S970S	XP_005245844.1
XM_005245788.1	2951	Silent Mutation	AGC,AGT	S969S	XP_005245845.1

Gene: LOC101927895
Gene Name: uncharacterized LOC101927895

There are no transcripts associated with this gene.

Gene: UBR4
Gene Name: ubiquitin protein ligase E3 component n-recognin 4

There are no transcripts associated with this gene.

View Full Product Details