Product Details

SNP ID: rs193014623
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.19:19677974 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGATGTGACGCTGGAAACCTTCAG[A/G]AACCTGGCCTCGGTCGGTAAGAAGG
Phenotype: MIM: 603983
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: ZNF101 PubMed Links
Additional Information: For this assay, SNP(s) [rs16996227] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300949.1		Intron			NP_001287878.1
NM_033204.3		Intron			NP_149981.2