Product Details

SNP ID: rs612211
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55639105 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGACACTCAGGTTGGATAATTGTC[T/C]AAGTAGACCAGGGGTTCTCAGCTAG
Phenotype: MIM: 613478
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: CCDC106 PubMed Links

Gene Details

Gene: CCDC106
Gene Name: coiled-coil domain containing 106

There are no transcripts associated with this gene.

Gene: LOC107983998
Gene Name: uncharacterized LOC107983998

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011527018.2		Intron			XP_011525320.1
XM_011527021.1		Intron			XP_011525323.1

Gene: ZNF580
Gene Name: zinc finger protein 580

There are no transcripts associated with this gene.

Gene: ZNF581
Gene Name: zinc finger protein 581

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016535.3		Intron			NP_057619.1
XM_006723240.3		Intron			XP_006723303.1
XM_017026867.1		Intron			XP_016882356.1

View Full Product Details