Product Details

SNP ID: rs7607995
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:74424186 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTTTATAGTTAATTAAGACTTTAT[A/C]ATACTGATGTGAAATGAGGAGTTGG
Phenotype: MIM: 602288
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: C2orf81 PubMed Links

Gene Details

Gene: C2orf81
Gene Name: chromosome 2 open reading frame 81

There are no transcripts associated with this gene.

Gene: RTKN
Gene Name: rhotekin

There are no transcripts associated with this gene.

Gene: WDR54
Gene Name: WD repeat domain 54

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320823.1		Intron			NP_001307752.1
NM_001320824.1		Intron			NP_001307753.1
NM_001320825.1		Intron			NP_001307754.1
NM_032118.3		Intron			NP_115494.1
XM_017005064.1		Intron			XP_016860553.1

View Full Product Details