Product Details

SNP ID
rs200513165
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.10:73498884 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TGCTAGATGGTGGGTACACAGGATG[A/G]ACAATGGGAGGGTGGGAGGGTGAAT
Phenotype
MIM: 114106
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
PPP3CB PubMed Links

Gene Details

Gene
PPP3CB
Gene Name
protein phosphatase 3 catalytic subunit beta
There are no transcripts associated with this gene.

Gene
PPP3CB-AS1
Gene Name
PPP3CB antisense RNA 1 (head to head)
There are no transcripts associated with this gene.

Gene
USP54
Gene Name
ubiquitin specific peptidase 54
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001320437.1 4704 Silent Mutation GTC,GTT V1538V NP_001307366.1
NM_001320441.1 4704 Intron NP_001307370.1
NM_152586.3 4704 Silent Mutation GTC,GTT V1600V NP_689799.3
XM_005269582.2 4704 Silent Mutation GTC,GTT V1496V XP_005269639.1
XM_011539368.2 4704 Silent Mutation GTC,GTT V1565V XP_011537670.1
XM_017015759.1 4704 Silent Mutation GTC,GTT V1624V XP_016871248.1
XM_017015760.1 4704 Silent Mutation GTC,GTT V1624V XP_016871249.1
XM_017015761.1 4704 Silent Mutation GTC,GTT V1624V XP_016871250.1
XM_017015762.1 4704 Silent Mutation GTC,GTT V1624V XP_016871251.1
XM_017015763.1 4704 Silent Mutation GTC,GTT V1624V XP_016871252.1
XM_017015764.1 4704 Silent Mutation GTC,GTT V1624V XP_016871253.1
XM_017015765.1 4704 Silent Mutation GTC,GTT V1624V XP_016871254.1
XM_017015766.1 4704 Silent Mutation GTC,GTT V1624V XP_016871255.1
XM_017015767.1 4704 Silent Mutation GTC,GTT V1624V XP_016871256.1
XM_017015768.1 4704 Silent Mutation GTC,GTT V1624V XP_016871257.1
XM_017015769.1 4704 Silent Mutation GTC,GTT V1624V XP_016871258.1
XM_017015770.1 4704 Silent Mutation GTC,GTT V1624V XP_016871259.1
XM_017015771.1 4704 Silent Mutation GTC,GTT V1622V XP_016871260.1
XM_017015772.1 4704 Silent Mutation GTC,GTT V1619V XP_016871261.1
XM_017015773.1 4704 Silent Mutation GTC,GTT V1602V XP_016871262.1
XM_017015774.1 4704 Silent Mutation GTC,GTT V1600V XP_016871263.1
XM_017015775.1 4704 Silent Mutation GTC,GTT V1600V XP_016871264.1
XM_017015776.1 4704 Silent Mutation GTC,GTT V1600V XP_016871265.1
XM_017015777.1 4704 Silent Mutation GTC,GTT V1600V XP_016871266.1
XM_017015778.1 4704 Silent Mutation GTC,GTT V1584V XP_016871267.1
XM_017015779.1 4704 Silent Mutation GTC,GTT V1577V XP_016871268.1
XM_017015780.1 4704 Silent Mutation GTC,GTT V1572V XP_016871269.1
XM_017015781.1 4704 Silent Mutation GTC,GTT V1567V XP_016871270.1
XM_017015782.1 4704 Silent Mutation GTC,GTT V1560V XP_016871271.1
XM_017015783.1 4704 Silent Mutation GTC,GTT V1543V XP_016871272.1
XM_017015784.1 4704 Silent Mutation GTC,GTT V1543V XP_016871273.1
XM_017015785.1 4704 Silent Mutation GTC,GTT V1537V XP_016871274.1
XM_017015786.1 4704 Silent Mutation GTC,GTT V1503V XP_016871275.1

View Full Product Details